pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol ID2   
Synonyms GIG8, ID2A, ID2H, bHLHb26
Description inhibitor of DNA binding 2, HLH protein
Transcript NM_002166   
Expression
Putative miRNA Targets on ID2
3'UTR of ID2
(miRNA target sites are highlighted)
>ID2|NM_002166|3'UTR
   1 ATAAGCGGTGTTCATGATTTCTTTTATTCTTTGCACAACAACAACAACAACAAATTCACGGAATCTTTTAAGTGCTGAAC
  81 TTATTTTTCAACCATTTCACAAGGAGGACAAGTTGAATGGACCTTTTTAAAAAGAAAAAAAAAATGGAAGGAAAACTAAG
 161 AATGATCATCTTCCCAGGGTGTTCTCTTACTTGGACTGTGATATTCGTTATTTATGAAAAAGACTTTTAAATGCCCTTTC
 241 TGCAGTTGGAAGGTTTTCTTTATATACTATTCCCACCATGGGGAGCGAAAACGTTAAAATCACAAGGAATTGCCCAATCT
 321 AAGCAGACTTTGCCTTTTTTCAAAGGTGGAGCGTGAATACCAGAAGGATCCAGTATTCAGTCACTTAAATGAAGTCTTTT
 401 GGTCAGAAATTACCTTTTTGACACAAGCCTACTGAATGCTGTGTATATATTTATATATAAATATATCTATTTGAGTGAAA
 481 CCTTGTGAACTCTTTAATTAGAGTTTTCTTGTATAGTGGCAGAGATGTCTATTTCTGCATTCAAAAGTGTAATGATGTAC
 561 TTATTCATGCTAAACTTTTTATAAAAGTTTAGTTGTAAACTTAACCCTTTTATACAAAATAAATCAAGTGTGTTTATTGA
 641 ATGGTGATTGCCTGCTTTATTTCAGAGGACCAGTGCTTTGATTTTTATTATGCTATGTTATAACTGAACCCAAATAAATA
 721 CAAGTTCAAATTTATGTAGACTGTATAAGATTATAATAAAACATGTCTGAAGTCAAAAAAAAAAAAAAAAAAAAAAAAAA
 801 AAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agucggcgacaguguGCGUGUc 5'
                         :||||| 
Target 5' atttcttttattcttTGCACAa 3'
17 - 38 104.00 -7.10
2
miRNA  3' agucggcgACAGUG-UGCGUGuc 5'
                  ||| |: |:|:||  
Target 5' ttcaaaagTGTAATGATGTACtt 3'
540 - 562 98.00 -6.90
3
miRNA  3' agUCGG-CGAC--AGUGUGCGUGUc 5'
            ||||  |||  |  :::|:|:| 
Target 5' caAGCCTACTGAATGCTGTGTATAt 3'
424 - 448 90.00 -9.32
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26963858 12 COSMIC
COSN19692034 51 COSMIC
COSN24390826 58 COSMIC
COSN8609803 60 COSMIC
COSN20040438 62 COSMIC
COSN26979581 69 COSMIC
COSN23093779 82 COSMIC
COSN25100250 85 COSMIC
COSN19631115 135 COSMIC
COSN23754549 193 COSMIC
COSN15965570 253 COSMIC
COSN1861785 485 COSMIC
COSN29985790 600 COSMIC
COSN21571400 628 COSMIC
COSN1243885 827 COSMIC
COSN27260503 923 COSMIC
COSN31570567 980 COSMIC
COSN31485551 1175 COSMIC
COSN31577188 1325 COSMIC
COSN31542932 1429 COSMIC
COSN31595056 1446 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs545689941 2 dbSNP
rs745768418 4 dbSNP
rs1163767410 5 dbSNP
rs755701807 6 dbSNP
rs777266112 7 dbSNP
rs1418560989 8 dbSNP
rs757859222 13 dbSNP
rs1178509202 14 dbSNP
rs748895574 15 dbSNP
rs756708598 16 dbSNP
rs779522291 17 dbSNP
rs1413934835 19 dbSNP
rs377037800 20 dbSNP
rs564886395 23 dbSNP
rs1027875438 27 dbSNP
rs979385018 29 dbSNP
rs1269176740 30 dbSNP
rs1251144645 32 dbSNP
rs1340311364 33 dbSNP
rs935346820 36 dbSNP
rs951043696 40 dbSNP
rs775949491 43 dbSNP
rs368596105 44 dbSNP
rs372282921 45 dbSNP
rs917830703 47 dbSNP
rs779547144 48 dbSNP
rs960481095 48 dbSNP
rs527701869 49 dbSNP
rs746495103 49 dbSNP
rs768347512 50 dbSNP
rs762013661 52 dbSNP
rs1284651842 53 dbSNP
rs374104552 56 dbSNP
rs1196504357 57 dbSNP
rs1393369344 58 dbSNP
rs200036190 58 dbSNP
rs3053671 58 dbSNP
rs369815857 58 dbSNP
rs898225672 58 dbSNP
rs533546964 60 dbSNP
rs540323460 61 dbSNP
rs777580956 62 dbSNP
rs1437447713 64 dbSNP
rs1182635501 75 dbSNP
rs1203558653 75 dbSNP
rs530261721 82 dbSNP
rs1234605471 84 dbSNP
rs374163542 87 dbSNP
rs886737541 88 dbSNP
rs923840855 91 dbSNP
rs769109978 93 dbSNP
rs1228587586 99 dbSNP
rs1019189405 100 dbSNP
rs902126096 102 dbSNP
rs1053117105 104 dbSNP
rs996347688 108 dbSNP
rs1402678900 117 dbSNP
rs890478695 124 dbSNP
rs774807155 125 dbSNP
rs1374812775 128 dbSNP
rs140172462 132 dbSNP
rs80280742 135 dbSNP
rs1410129511 138 dbSNP
rs1330317236 139 dbSNP
rs532260886 144 dbSNP
rs1484893473 145 dbSNP
rs868608897 146 dbSNP
rs1206423979 147 dbSNP
rs1283904720 148 dbSNP
rs1028242335 149 dbSNP
rs1340745956 150 dbSNP
rs1314390961 151 dbSNP
rs552524818 157 dbSNP
rs950995986 160 dbSNP
rs1347315944 162 dbSNP
rs565648612 163 dbSNP
rs534587167 164 dbSNP
rs1398756344 168 dbSNP
rs1269315425 172 dbSNP
rs1034679213 178 dbSNP
rs917834850 179 dbSNP
rs1190314141 180 dbSNP
rs960384405 183 dbSNP
rs1257171610 184 dbSNP
rs990505060 185 dbSNP
rs1023362097 186 dbSNP
rs967792557 187 dbSNP
rs554635392 196 dbSNP
rs1489893262 204 dbSNP
rs1274681633 210 dbSNP
rs113690930 213 dbSNP
rs935248954 216 dbSNP
rs987143777 218 dbSNP
rs568157668 222 dbSNP
rs766497047 224 dbSNP
rs1481700427 231 dbSNP
rs1333951741 234 dbSNP
rs931142207 235 dbSNP
rs1046807447 242 dbSNP
rs1167377810 247 dbSNP
rs769849495 252 dbSNP
rs1417616467 259 dbSNP
rs1160431864 260 dbSNP
rs1362631366 263 dbSNP
rs1181651235 264 dbSNP
rs886895694 270 dbSNP
rs943676347 271 dbSNP
rs1041139366 276 dbSNP
rs1268338005 278 dbSNP
rs1225318570 280 dbSNP
rs537189047 283 dbSNP
rs900557886 290 dbSNP
rs1233798468 291 dbSNP
rs551458222 295 dbSNP
rs1049223708 297 dbSNP
rs1481361965 300 dbSNP
rs1050713653 301 dbSNP
rs866508539 302 dbSNP
rs1394074132 304 dbSNP
rs886637954 305 dbSNP
rs903998981 310 dbSNP
rs1406160629 313 dbSNP
rs1158532361 318 dbSNP
rs1000993532 319 dbSNP
rs1478616733 319 dbSNP
rs1005116834 321 dbSNP
rs577345215 330 dbSNP
rs1453265807 333 dbSNP
rs187316081 336 dbSNP
rs956822703 338 dbSNP
rs1169237817 339 dbSNP
rs1013568963 350 dbSNP
rs1382981457 351 dbSNP
rs192214854 354 dbSNP
rs969426577 355 dbSNP
rs546393647 356 dbSNP
rs1011885691 359 dbSNP
rs1232261438 360 dbSNP
rs1367386574 366 dbSNP
rs1023344344 368 dbSNP
rs919843243 371 dbSNP
rs967781290 377 dbSNP
rs1318137050 380 dbSNP
rs759504861 385 dbSNP
rs1229307840 387 dbSNP
rs1424149435 388 dbSNP
rs1172302806 392 dbSNP
rs74467097 395 dbSNP
rs183093556 397 dbSNP
rs1474194442 398 dbSNP
rs185992340 398 dbSNP
rs1245417809 399 dbSNP
rs1241133704 405 dbSNP
rs1292520488 407 dbSNP
rs558838352 409 dbSNP
rs764892512 412 dbSNP
rs920900762 429 dbSNP
rs1209996240 431 dbSNP
rs912443210 434 dbSNP
rs942625258 438 dbSNP
rs974713503 440 dbSNP
rs752549429 441 dbSNP
rs371845381 444 dbSNP
rs562999827 444 dbSNP
rs1447986937 446 dbSNP
rs930718289 446 dbSNP
rs763083758 456 dbSNP
rs1195741946 460 dbSNP
rs1357695011 461 dbSNP
rs1311598478 465 dbSNP
rs374952354 470 dbSNP
rs1052581856 473 dbSNP
rs572438956 473 dbSNP
rs541003847 474 dbSNP
rs190266143 476 dbSNP
rs367570821 478 dbSNP
rs1418429122 480 dbSNP
rs1163463627 481 dbSNP
rs1476071578 483 dbSNP
rs34945847 484 dbSNP
rs80204205 484 dbSNP
rs543900939 485 dbSNP
rs1163668601 488 dbSNP
rs1187166101 491 dbSNP
rs757924221 493 dbSNP
rs182538570 495 dbSNP
rs768832154 503 dbSNP
rs1451569343 504 dbSNP
rs1157974043 505 dbSNP
rs1234060482 507 dbSNP
rs1385536392 512 dbSNP
rs896737044 517 dbSNP
rs952634682 519 dbSNP
rs2306067 525 dbSNP
rs1439460031 526 dbSNP
rs1353352705 528 dbSNP
rs1326171181 530 dbSNP
rs1415184480 532 dbSNP
rs908353260 532 dbSNP
rs369020462 536 dbSNP
rs1164006076 538 dbSNP
rs1453376094 547 dbSNP
rs1410147617 554 dbSNP
rs1175352513 557 dbSNP
rs1023293356 558 dbSNP
rs1479702148 566 dbSNP
rs552438486 569 dbSNP
rs1214578368 570 dbSNP
rs1000553136 572 dbSNP
rs1470031423 574 dbSNP
rs1271474343 580 dbSNP
rs1031137240 586 dbSNP
rs956488788 587 dbSNP
rs1452109598 589 dbSNP
rs1309798685 593 dbSNP
rs188226977 594 dbSNP
rs976874084 596 dbSNP
rs1315863752 598 dbSNP
rs1442432184 606 dbSNP
rs1008435546 613 dbSNP
rs557273414 614 dbSNP
rs1323530680 622 dbSNP
rs1236947941 623 dbSNP
rs921027735 625 dbSNP
rs192510893 627 dbSNP
rs1210984457 634 dbSNP
rs1156877315 635 dbSNP
rs1042740438 637 dbSNP
rs1395586547 650 dbSNP
rs1194388659 656 dbSNP
rs1455638930 668 dbSNP
rs1251429423 671 dbSNP
rs963923171 672 dbSNP
rs925527269 673 dbSNP
rs1213233227 677 dbSNP
rs182750881 684 dbSNP
rs975332466 697 dbSNP
rs921921179 699 dbSNP
rs55760294 700 dbSNP
rs1364373794 701 dbSNP
rs1347501372 709 dbSNP
rs551653984 714 dbSNP
rs1304808863 715 dbSNP
rs1046914887 716 dbSNP
rs905310373 717 dbSNP
rs1302242807 718 dbSNP
rs984822846 719 dbSNP
rs907918934 722 dbSNP
rs1469503549 724 dbSNP
rs940789975 724 dbSNP
rs1363844286 727 dbSNP
rs1286950264 728 dbSNP
rs1452744161 731 dbSNP
rs560855290 733 dbSNP
rs1056637237 737 dbSNP
rs1175424174 741 dbSNP
rs1436671660 741 dbSNP
rs918117198 747 dbSNP
rs1198460091 751 dbSNP
rs780383502 753 dbSNP
rs1004104885 757 dbSNP
rs1488162963 760 dbSNP
rs1389816015 763 dbSNP
rs1281683882 769 dbSNP
rs1213565344 770 dbSNP
rs568055526 773 dbSNP
rs1306308358 774 dbSNP
rs1308932479 775 dbSNP
rs536697369 781 dbSNP
rs1292990797 783 dbSNP
rs1336874311 794 dbSNP
rs188919269 796 dbSNP
rs1045317809 798 dbSNP
rs1261685324 800 dbSNP
rs904115166 804 dbSNP
rs1323331740 807 dbSNP
rs1204672217 809 dbSNP
rs1000903246 811 dbSNP
rs1462561808 812 dbSNP
rs1028484617 813 dbSNP
rs1258607898 813 dbSNP
rs778021904 813 dbSNP
rs965547270 813 dbSNP
rs1479444963 815 dbSNP
rs953850632 817 dbSNP
rs1485006455 824 dbSNP
rs1256030190 828 dbSNP
rs1195941303 833 dbSNP
rs570115222 834 dbSNP
rs978380833 839 dbSNP
rs925591279 840 dbSNP
rs1217558720 843 dbSNP
rs934334335 844 dbSNP
rs1294842700 851 dbSNP
rs192378104 853 dbSNP
rs1052108387 855 dbSNP
rs184340832 856 dbSNP
rs1392053876 858 dbSNP
rs1398644039 859 dbSNP
rs1296700178 862 dbSNP
rs1428490384 863 dbSNP
rs949575603 871 dbSNP
rs1474427923 872 dbSNP
rs1008012963 873 dbSNP
rs1480663594 875 dbSNP
rs1368453111 882 dbSNP
rs1183093037 883 dbSNP
rs1166018973 885 dbSNP
rs1178318683 893 dbSNP
rs1019395591 896 dbSNP
rs963872738 897 dbSNP
rs1197646394 900 dbSNP
rs780962060 902 dbSNP
rs1460596655 907 dbSNP
rs1468679986 909 dbSNP
rs1274661019 912 dbSNP
rs1211653779 913 dbSNP
rs371946564 913 dbSNP
rs879061437 913 dbSNP
rs1297710132 920 dbSNP
rs1241047879 923 dbSNP
rs768679525 924 dbSNP
rs1305021615 926 dbSNP
rs938086943 928 dbSNP
rs1048524634 934 dbSNP
rs1328153079 937 dbSNP
rs1411716086 944 dbSNP
rs1281969736 946 dbSNP
rs187229888 948 dbSNP
rs756804161 949 dbSNP
rs1224569017 951 dbSNP
rs767246383 953 dbSNP
rs1392814821 954 dbSNP
rs1362540944 956 dbSNP
rs1004219198 959 dbSNP
rs1303784973 963 dbSNP
rs1454324110 969 dbSNP
rs1254511749 974 dbSNP
rs1211367659 976 dbSNP
rs1305410826 978 dbSNP
rs557173478 981 dbSNP
rs952668295 983 dbSNP
rs1251409867 986 dbSNP
rs1284635800 989 dbSNP
rs1206652131 991 dbSNP
rs1285212823 995 dbSNP
rs985157317 995 dbSNP
rs1015519316 997 dbSNP
rs1219582584 1001 dbSNP
rs1268180334 1003 dbSNP
rs1434527112 1010 dbSNP
rs750306186 1014 dbSNP
rs907902843 1014 dbSNP
rs962425103 1015 dbSNP
rs541335646 1019 dbSNP
rs1402769984 1025 dbSNP
rs1383510189 1030 dbSNP
rs1158515610 1045 dbSNP
rs992266908 1047 dbSNP
rs760542686 1048 dbSNP
rs948171539 1049 dbSNP
rs1426984585 1050 dbSNP
rs1477520846 1057 dbSNP
rs1242309579 1059 dbSNP
rs1045263841 1061 dbSNP
rs1802549 1062 dbSNP
rs1170068080 1065 dbSNP
rs1802550 1067 dbSNP
rs1195149507 1085 dbSNP
rs901125964 1086 dbSNP
rs998416099 1094 dbSNP
rs925485420 1095 dbSNP
rs780888490 1096 dbSNP
rs1052525078 1098 dbSNP
rs1217523587 1103 dbSNP
rs978446044 1107 dbSNP
rs1301353993 1113 dbSNP
rs892162200 1122 dbSNP
rs561735228 1126 dbSNP
rs574798390 1132 dbSNP
rs1298153548 1139 dbSNP
rs1415889801 1140 dbSNP
rs955700680 1142 dbSNP
rs988470415 1145 dbSNP
rs1295688493 1149 dbSNP
rs755302298 1156 dbSNP
rs1169226857 1158 dbSNP
rs1474304694 1161 dbSNP
rs140487184 1165 dbSNP
rs543520892 1165 dbSNP
rs1188598327 1167 dbSNP
rs1214331964 1168 dbSNP
rs1295901120 1172 dbSNP
rs914126176 1175 dbSNP
rs1040749488 1181 dbSNP
rs1441857923 1183 dbSNP
rs1273981716 1192 dbSNP
rs1216509672 1193 dbSNP
rs949684920 1193 dbSNP
rs982788644 1193 dbSNP
rs926783899 1197 dbSNP
rs938169886 1203 dbSNP
rs1290327760 1205 dbSNP
rs899605677 1207 dbSNP
rs1354546338 1208 dbSNP
rs527712287 1210 dbSNP
rs1048470546 1218 dbSNP
rs1463686407 1224 dbSNP
rs996601385 1227 dbSNP
rs1422443638 1228 dbSNP
rs1026778380 1230 dbSNP
rs888359269 1234 dbSNP
rs1165429571 1235 dbSNP
rs868005555 1237 dbSNP
rs1476061851 1238 dbSNP
rs577807398 1240 dbSNP
rs939998187 1241 dbSNP
rs1037066212 1242 dbSNP
rs1233479164 1242 dbSNP
rs1485444558 1243 dbSNP
rs1456643878 1246 dbSNP
rs1337328912 1250 dbSNP
rs901069258 1250 dbSNP
rs1311210075 1260 dbSNP
rs1186880253 1261 dbSNP
rs1373450611 1269 dbSNP
rs1280833139 1271 dbSNP
rs56114166 1272 dbSNP
rs748235392 1272 dbSNP
rs1326149588 1274 dbSNP
rs1399177899 1274 dbSNP
rs1462824280 1274 dbSNP
rs1347863457 1277 dbSNP
rs1164023747 1278 dbSNP
rs998091229 1278 dbSNP
rs1451494447 1281 dbSNP
rs1161752417 1286 dbSNP
rs1410036694 1287 dbSNP
rs371228469 1290 dbSNP
rs1406487133 1294 dbSNP
rs192055392 1306 dbSNP
rs1167590771 1308 dbSNP
rs56392909 1308 dbSNP
rs1050114924 1312 dbSNP
rs1470131223 1314 dbSNP
rs1263993416 1319 dbSNP
rs577296674 1321 dbSNP
rs1318090474 1322 dbSNP
rs992173044 1323 dbSNP
rs563781764 1330 dbSNP
rs889586230 1331 dbSNP
rs1000021926 1339 dbSNP
rs184949920 1340 dbSNP
rs373341223 1341 dbSNP
rs13401658 1342 dbSNP
rs1449961027 1343 dbSNP
rs955818332 1349 dbSNP
rs1454120106 1360 dbSNP
rs1346955563 1368 dbSNP
rs1313763711 1371 dbSNP
rs1417940959 1372 dbSNP
rs1379723126 1373 dbSNP
rs1174517396 1379 dbSNP
rs1382947835 1386 dbSNP
rs1265494279 1399 dbSNP
rs1229505072 1401 dbSNP
rs1191047371 1403 dbSNP
rs1282146086 1404 dbSNP
rs1486389273 1404 dbSNP
rs762424092 1404 dbSNP
rs1009837922 1405 dbSNP
rs1316252314 1416 dbSNP
rs1235810632 1417 dbSNP
rs1310146035 1431 dbSNP
rs1216250713 1434 dbSNP
rs781685596 1439 dbSNP
rs150333363 1441 dbSNP
rs1025027599 1443 dbSNP
rs969462019 1447 dbSNP
rs971484370 1450 dbSNP
rs1399265660 1456 dbSNP
rs1181929141 1460 dbSNP
rs1375966137 1460 dbSNP
rs1313599042 1465 dbSNP
rs1242739426 1466 dbSNP
rs1467644346 1469 dbSNP
rs1376194629 1470 dbSNP
rs1175554022 1472 dbSNP
rs982353060 1472 dbSNP
rs980932018 1474 dbSNP
rs925510168 1475 dbSNP
rs926871010 1477 dbSNP
rs959526220 1483 dbSNP
rs375466228 1484 dbSNP
rs909958590 1490 dbSNP
rs984325448 1490 dbSNP
rs1473191980 1500 dbSNP
rs936908465 1505 dbSNP
rs1183668683 1506 dbSNP
rs1481957712 1515 dbSNP
rs1255058947 1516 dbSNP
rs988436839 1519 dbSNP
rs1400578693 1520 dbSNP
rs56050726 1524 dbSNP
rs1037543763 1525 dbSNP
rs1314632140 1526 dbSNP
rs1397871724 1527 dbSNP
rs922593048 1530 dbSNP
rs943678400 1535 dbSNP
rs147763639 1541 dbSNP
rs899553506 1544 dbSNP
rs932443603 1546 dbSNP
rs1477694090 1549 dbSNP
rs1419231489 1550 dbSNP
rs1197123145 1551 dbSNP
rs1277200611 1552 dbSNP
rs1190144469 1553 dbSNP
rs1421580796 1555 dbSNP
rs1048689180 1557 dbSNP
rs189748725 1558 dbSNP
rs1054240102 1559 dbSNP
rs1004471687 1561 dbSNP
rs527938224 1563 dbSNP
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.464 0 -0.446 0 50 Click to see details
BLCA -0.671 0 -0.697 0 18 Click to see details
STAD -0.471 0 -0.479 0 32 Click to see details
UCEC -0.544 0.01 -0.461 0.02 19 Click to see details
PAAD -0.979 0.01 -0.800 0.1 4 Click to see details
HNSC -0.26 0.05 -0.174 0.14 42 Click to see details
KIRC -0.191 0.06 -0.061 0.31 68 Click to see details
CHOL -0.557 0.06 -0.550 0.06 9 Click to see details
LUAD -0.46 0.07 -0.350 0.13 12 Click to see details
LUSC -0.208 0.11 -0.087 0.3 38 Click to see details
THCA -0.163 0.11 -0.197 0.07 59 Click to see details
ESCA -0.388 0.12 -0.455 0.08 11 Click to see details
BRCA -0.117 0.14 -0.099 0.19 84 Click to see details
KIRP -0.189 0.15 -0.191 0.15 32 Click to see details
COAD 0.398 0.16 0.238 0.29 8 Click to see details
PCPG -0.867 0.17 -1.000 0.5 3 Click to see details
LIHC 0.07 0.32 0.033 0.41 49 Click to see details
CESC 0.313 0.4 0.500 0.33 3 Click to see details
KICH 0.035 0.43 0.008 0.48 25 Click to see details
KICH 0.035 0.43 0.008 0.48 25 Click to see details
KICH 0.035 0.43 0.008 0.48 25 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission