pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-325 |
Genomic Coordinates | chrX: 105379082 - 105379179 |
Synonyms | Mirn325, mmu-mir-325, Mir325 |
Description | Mus musculus miR-325 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-325-3p |
Sequence | 54| UUUAUUGAGCACCUCCUAUCAA |75 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Ghrhr | |||||||||||||||
Synonyms | Ghrfr, lit, little | |||||||||||||||
Description | growth hormone releasing hormone receptor | |||||||||||||||
Transcript | NM_001003685 | |||||||||||||||
Expression | ||||||||||||||||
Putative miRNA Targets on Ghrhr | ||||||||||||||||
3'UTR of Ghrhr (miRNA target sites are highlighted) |
>Ghrhr|NM_001003685|3'UTR 1 GCCAGCCATCATCACAAGGGCCAAGCCCCAAACCCTGTGCTCAAACTGTCATGGCACCACGGGCAATGCGGTCCTCCCTA 81 CCGTTCTCCTTCCCCTTCTCTGCATCTGCTTTCTCCAGGTCCCCGTATATCAACCTTCGACTTTCTCAGTTCCTGCATCT 161 GCTCCCATCTGTTCTTTCTTCCCATCTAGGGCTATTGCCCAAGGCCCAGAGAAACCAATAAACTTGTACACGAGTG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
|||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
27 mmu-miR-325-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT054600 | Arc | activity regulated cytoskeletal-associated protein | 3 | 1 | ||||||||
MIRT577829 | Rinl | Ras and Rab interactor-like | 1 | 1 | ||||||||
MIRT577905 | Prr11 | proline rich 11 | 1 | 1 | ||||||||
MIRT578380 | Krtap6-1 | keratin associated protein 6-1 | 1 | 1 | ||||||||
MIRT578550 | Hsd17b1 | hydroxysteroid (17-beta) dehydrogenase 1 | 1 | 1 | ||||||||
MIRT578770 | Gemin8 | gem nuclear organelle associated protein 8 | 1 | 1 | ||||||||
MIRT580288 | Trhr | thyrotropin releasing hormone receptor | 1 | 1 | ||||||||
MIRT581518 | Ptprd | protein tyrosine phosphatase, receptor type, D | 1 | 1 | ||||||||
MIRT582779 | Kif1c | kinesin family member 1C | 1 | 1 | ||||||||
MIRT585752 | Stard6 | StAR-related lipid transfer (START) domain containing 6 | 1 | 1 | ||||||||
MIRT587310 | Ephx3 | epoxide hydrolase 3 | 1 | 4 | ||||||||
MIRT588735 | Taok3 | TAO kinase 3 | 1 | 1 | ||||||||
MIRT592550 | Mup7 | major urinary protein 7 | 1 | 1 | ||||||||
MIRT592592 | Mup13 | major urinary protein 13 | 1 | 1 | ||||||||
MIRT594207 | Wdr12 | WD repeat domain 12 | 1 | 1 | ||||||||
MIRT594462 | Epyc | epiphycan | 1 | 1 | ||||||||
MIRT594693 | Atp11b | ATPase, class VI, type 11B | 1 | 1 | ||||||||
MIRT594929 | Gjb2 | gap junction protein, beta 2 | 1 | 1 | ||||||||
MIRT594934 | Frem3 | Fras1 related extracellular matrix protein 3 | 1 | 1 | ||||||||
MIRT595784 | Hlf | hepatic leukemia factor | 1 | 1 | ||||||||
MIRT595846 | Set | SET nuclear oncogene | 1 | 1 | ||||||||
MIRT595897 | Cd69 | CD69 antigen | 1 | 1 | ||||||||
MIRT603010 | Klk8 | kallikrein related-peptidase 8 | 1 | 1 | ||||||||
MIRT603579 | Ppm1k | protein phosphatase 1K (PP2C domain containing) | 1 | 1 | ||||||||
MIRT604052 | Esf1 | ESF1 nucleolar pre-rRNA processing protein homolog | 1 | 1 | ||||||||
MIRT736870 | GHRHR | growth hormone releasing hormone receptor | 2 | 0 | ||||||||
MIRT756335 | Gsdmd | gasdermin D | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|