pre-miRNA Information
pre-miRNA mmu-mir-325   
Genomic Coordinates chrX: 105379082 - 105379179
Synonyms Mirn325, mmu-mir-325, Mir325
Description Mus musculus miR-325 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-325-3p
Sequence 54| UUUAUUGAGCACCUCCUAUCAA |75
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Ghrhr   
Synonyms Ghrfr, lit, little
Description growth hormone releasing hormone receptor
Transcript NM_001003685   
Expression
Putative miRNA Targets on Ghrhr
3'UTR of Ghrhr
(miRNA target sites are highlighted)
>Ghrhr|NM_001003685|3'UTR
   1 GCCAGCCATCATCACAAGGGCCAAGCCCCAAACCCTGTGCTCAAACTGTCATGGCACCACGGGCAATGCGGTCCTCCCTA
  81 CCGTTCTCCTTCCCCTTCTCTGCATCTGCTTTCTCCAGGTCCCCGTATATCAACCTTCGACTTTCTCAGTTCCTGCATCT
 161 GCTCCCATCTGTTCTTTCTTCCCATCTAGGGCTATTGCCCAAGGCCCAGAGAAACCAATAAACTTGTACACGAGTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aacuauccuccacgaGUUAUUu 5'
                         |||||| 
Target 5' aaggcccagagaaacCAATAAa 3'
201 - 222 120.00 -5.50
2
miRNA  3' aacuauccucCACGAGUUauuu 5'
                    ||||||||    
Target 5' cccaaaccctGTGCTCAAactg 3'
27 - 48 100.00 -8.76
27 mmu-miR-325-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054600 Arc activity regulated cytoskeletal-associated protein 3 1
MIRT577829 Rinl Ras and Rab interactor-like 1 1
MIRT577905 Prr11 proline rich 11 1 1
MIRT578380 Krtap6-1 keratin associated protein 6-1 1 1
MIRT578550 Hsd17b1 hydroxysteroid (17-beta) dehydrogenase 1 1 1
MIRT578770 Gemin8 gem nuclear organelle associated protein 8 1 1
MIRT580288 Trhr thyrotropin releasing hormone receptor 1 1
MIRT581518 Ptprd protein tyrosine phosphatase, receptor type, D 1 1
MIRT582779 Kif1c kinesin family member 1C 1 1
MIRT585752 Stard6 StAR-related lipid transfer (START) domain containing 6 1 1
MIRT587310 Ephx3 epoxide hydrolase 3 1 4
MIRT588735 Taok3 TAO kinase 3 1 1
MIRT592550 Mup7 major urinary protein 7 1 1
MIRT592592 Mup13 major urinary protein 13 1 1
MIRT594207 Wdr12 WD repeat domain 12 1 1
MIRT594462 Epyc epiphycan 1 1
MIRT594693 Atp11b ATPase, class VI, type 11B 1 1
MIRT594929 Gjb2 gap junction protein, beta 2 1 1
MIRT594934 Frem3 Fras1 related extracellular matrix protein 3 1 1
MIRT595784 Hlf hepatic leukemia factor 1 1
MIRT595846 Set SET nuclear oncogene 1 1
MIRT595897 Cd69 CD69 antigen 1 1
MIRT603010 Klk8 kallikrein related-peptidase 8 1 1
MIRT603579 Ppm1k protein phosphatase 1K (PP2C domain containing) 1 1
MIRT604052 Esf1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT736870 GHRHR growth hormone releasing hormone receptor 2 0
MIRT756335 Gsdmd gasdermin D 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-325 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-325 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-325 Cisplatin approved 84093 Microarray CNE cells 22614822 2012 up-regulated
miR-325 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
miR-325-3p Urocortin 2 NULL 56843276 Quantitative real-time PCR anterior pituitary cells 22252941 2012 up-regulated

Error report submission