pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-410 |
Genomic Coordinates | chr12: 109743715 - 109743795 |
Synonyms | Mirn410, mmu-mir-410, Mir410 |
Description | Mus musculus miR-410 stem-loop |
Comment | Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse . |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-410-3p |
Sequence | 50| AAUAUAACACAGAUGGCCUGU |70 |
Evidence | Experimental |
Experiments | Northern |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Nos2 | ||||||||||||||||||||
Synonyms | MAC-NOS, NOS-II, Nos-2, Nos2a, i-NOS, iNOS | ||||||||||||||||||||
Description | nitric oxide synthase 2, inducible | ||||||||||||||||||||
Transcript | NM_010927 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Nos2 | |||||||||||||||||||||
3'UTR of Nos2 (miRNA target sites are highlighted) |
>Nos2|NM_010927|3'UTR 1 CAGCCCAGAGTTCCAGCTTCTGGCACTGAGTAAAGATAATGGTGAGGGGCTTGGGGAGACAGCGAAATGCAATCCCCCCC 81 AAGCCCCTCATGTCATTCCCCCCTCCTCCACCCTACCAAGTAGTATTGTACTATTGTGGACTACTAAATCTCTCTCCTCT 161 CCTCCCTCCCCTCTCTCCCTTTCCTCCCTTCTTCTCCACTCCCCAGCTCCCTCCTTCTCCTTCTCCTCCTTTGCCTCTCA 241 CTCTTCCTTGGAGCTGAGAGCAGAGAAAAACTCAACCTCCTGACTGAAGCACTTTGGGTGACCACCAGGAGGCACCATGC 321 CGCCGCTCTAATACTTAGCTGCACTATGTACAGATATTTATACTTCATATTTAAGAAAACAGATACTTTTGTCTACTCCC 401 AATGATGGCTTGGGCCTTTCCTGTATAATTCCTTGATGAAAAATATTTATATAAAATACATTTTATTTTAATCA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
154 mmu-miR-410-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT411453 | Timp3 | tissue inhibitor of metalloproteinase 3 | ![]() |
1 | 1 | |||||||
MIRT429039 | Nfib | nuclear factor I/B | ![]() |
1 | 1 | |||||||
MIRT577363 | Zbed6 | zinc finger, BED type containing 6 | ![]() |
1 | 1 | |||||||
MIRT577415 | Ugt2b35 | UDP glucuronosyltransferase 2 family, polypeptide B35 | ![]() |
1 | 1 | |||||||
MIRT577447 | Ttc17 | tetratricopeptide repeat domain 17 | ![]() |
1 | 1 | |||||||
MIRT577509 | Tmem100 | transmembrane protein 100 | ![]() |
1 | 1 | |||||||
MIRT577583 | Tcf21 | transcription factor 21 | ![]() |
1 | 1 | |||||||
MIRT577727 | Slc12a8 | solute carrier family 12 (potassium/chloride transporters), member 8 | ![]() |
1 | 1 | |||||||
MIRT577749 | Shh | sonic hedgehog | ![]() |
1 | 1 | |||||||
MIRT577866 | Rassf5 | Ras association (RalGDS/AF-6) domain family member 5 | ![]() |
1 | 1 | |||||||
MIRT577939 | Ppp6r1 | protein phosphatase 6, regulatory subunit 1 | ![]() |
1 | 1 | |||||||
MIRT577946 | Pou4f2 | POU domain, class 4, transcription factor 2 | ![]() |
1 | 1 | |||||||
MIRT577955 | Pm20d2 | peptidase M20 domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT578018 | Pfkl | phosphofructokinase, liver, B-type | ![]() |
1 | 2 | |||||||
MIRT578052 | Pcdhb17 | protocadherin beta 17 | ![]() |
1 | 1 | |||||||
MIRT578199 | Nadsyn1 | NAD synthetase 1 | ![]() |
1 | 1 | |||||||
MIRT578517 | Igfbp3 | insulin-like growth factor binding protein 3 | ![]() |
1 | 1 | |||||||
MIRT578557 | Hopx | HOP homeobox | ![]() |
1 | 1 | |||||||
MIRT578586 | Hist1h1d | histone cluster 1, H1d | ![]() |
1 | 1 | |||||||
MIRT578724 | Gm8369 | predicted gene 8369 | ![]() |
1 | 1 | |||||||
MIRT578808 | Folh1 | folate hydrolase 1 | ![]() |
1 | 1 | |||||||
MIRT578868 | Fam151b | family with sequence similarity 151, member B | ![]() |
1 | 1 | |||||||
MIRT579020 | Ctxn3 | cortexin 3 | ![]() |
1 | 1 | |||||||
MIRT579049 | Crp | C-reactive protein, pentraxin-related | ![]() |
1 | 1 | |||||||
MIRT579405 | Akna | AT-hook transcription factor | ![]() |
1 | 1 | |||||||
MIRT579630 | Mettl20 | electron transfer flavoprotein beta subunit lysine methyltransferase | ![]() |
1 | 1 | |||||||
MIRT579670 | 1200011I18Rik | GPALPP motifs containing 1 | ![]() |
1 | 1 | |||||||
MIRT579703 | Zmynd8 | zinc finger, MYND-type containing 8 | ![]() |
1 | 1 | |||||||
MIRT579745 | Zfp644 | zinc finger protein 644 | ![]() |
1 | 1 | |||||||
MIRT579786 | Zfp384 | zinc finger protein 384 | ![]() |
1 | 1 | |||||||
MIRT579807 | Zfp148 | zinc finger protein 148 | ![]() |
1 | 1 | |||||||
MIRT579834 | Zfand5 | zinc finger, AN1-type domain 5 | ![]() |
1 | 1 | |||||||
MIRT579839 | Zer1 | zyg-11 related, cell cycle regulator | ![]() |
1 | 1 | |||||||
MIRT579858 | Zc3hav1l | zinc finger CCCH-type, antiviral 1-like | ![]() |
1 | 1 | |||||||
MIRT579995 | Wnt3 | wingless-type MMTV integration site family, member 3 | ![]() |
1 | 1 | |||||||
MIRT580002 | Wnt11 | wingless-type MMTV integration site family, member 11 | ![]() |
1 | 1 | |||||||
MIRT580021 | Whsc1l1 | nuclear receptor binding SET domain protein 3 | ![]() |
1 | 1 | |||||||
MIRT580090 | Usp6nl | USP6 N-terminal like | ![]() |
1 | 1 | |||||||
MIRT580211 | Ttc39b | tetratricopeptide repeat domain 39B | ![]() |
1 | 1 | |||||||
MIRT580239 | Trps1 | transcriptional repressor GATA binding 1 | ![]() |
1 | 1 | |||||||
MIRT580243 | Trpc7 | transient receptor potential cation channel, subfamily C, member 7 | ![]() |
1 | 1 | |||||||
MIRT580411 | Tmem161b | transmembrane protein 161B | ![]() |
1 | 1 | |||||||
MIRT580506 | Tfam | transcription factor A, mitochondrial | ![]() |
1 | 1 | |||||||
MIRT580533 | Tead3 | TEA domain family member 3 | ![]() |
1 | 1 | |||||||
MIRT580554 | Tcf7l2 | transcription factor 7 like 2, T cell specific, HMG box | ![]() |
1 | 1 | |||||||
MIRT580568 | Tbx4 | T-box 4 | ![]() |
1 | 1 | |||||||
MIRT580612 | Syp | synaptophysin | ![]() |
1 | 1 | |||||||
MIRT580665 | Strbp | spermatid perinuclear RNA binding protein | ![]() |
1 | 1 | |||||||
MIRT580793 | Snx27 | sorting nexin family member 27 | ![]() |
1 | 1 | |||||||
MIRT580819 | Smurf2 | SMAD specific E3 ubiquitin protein ligase 2 | ![]() |
1 | 1 | |||||||
MIRT580868 | Slc8a1 | solute carrier family 8 (sodium/calcium exchanger), member 1 | ![]() |
1 | 1 | |||||||
MIRT580880 | Slc7a11 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 | ![]() |
1 | 1 | |||||||
MIRT580920 | Slc35a1 | solute carrier family 35 (CMP-sialic acid transporter), member 1 | ![]() |
1 | 1 | |||||||
MIRT581144 | Senp3 | SUMO/sentrin specific peptidase 3 | ![]() |
1 | 1 | |||||||
MIRT581245 | Rufy2 | RUN and FYVE domain-containing 2 | ![]() |
1 | 1 | |||||||
MIRT581261 | Rragb | Ras-related GTP binding B | ![]() |
1 | 1 | |||||||
MIRT581293 | Rnf166 | ring finger protein 166 | ![]() |
1 | 1 | |||||||
MIRT581352 | Ret | ret proto-oncogene | ![]() |
1 | 1 | |||||||
MIRT581388 | Rbms3 | RNA binding motif, single stranded interacting protein | ![]() |
1 | 1 | |||||||
MIRT581422 | Rasal2 | RAS protein activator like 2 | ![]() |
1 | 1 | |||||||
MIRT581453 | Ranbp10 | RAN binding protein 10 | ![]() |
1 | 1 | |||||||
MIRT581541 | Pten | phosphatase and tensin homolog | ![]() |
1 | 1 | |||||||
MIRT581573 | Prrx1 | paired related homeobox 1 | ![]() |
1 | 1 | |||||||
MIRT581589 | Lzts3 | leucine zipper, putative tumor suppressor family member 3 | ![]() |
1 | 1 | |||||||
MIRT581665 | Ppp4r2 | protein phosphatase 4, regulatory subunit 2 | ![]() |
1 | 1 | |||||||
MIRT581738 | Plxnc1 | plexin C1 | ![]() |
1 | 1 | |||||||
MIRT581791 | Plaur | plasminogen activator, urokinase receptor | ![]() |
1 | 1 | |||||||
MIRT581820 | Pkib | protein kinase inhibitor beta, cAMP dependent, testis specific | ![]() |
1 | 1 | |||||||
MIRT581893 | Phf17 | jade family PHD finger 1 | ![]() |
1 | 1 | |||||||
MIRT581982 | Pcsk5 | proprotein convertase subtilisin/kexin type 5 | ![]() |
1 | 1 | |||||||
MIRT582003 | Pcdh20 | protocadherin 20 | ![]() |
1 | 1 | |||||||
MIRT582052 | Osbp | oxysterol binding protein | ![]() |
1 | 1 | |||||||
MIRT582100 | Nupl2 | nucleoporin like 2 | ![]() |
1 | 1 | |||||||
MIRT582149 | Nol7 | nucleolar protein 7 | ![]() |
1 | 1 | |||||||
MIRT582156 | Nln | neurolysin (metallopeptidase M3 family) | ![]() |
1 | 1 | |||||||
MIRT582256 | Nckap5l | NCK-associated protein 5-like | ![]() |
1 | 1 | |||||||
MIRT582373 | Map1a | microtubule-associated protein 1 A | ![]() |
1 | 1 | |||||||
MIRT582410 | Mpped2 | metallophosphoesterase domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT582442 | Mgea5 | meningioma expressed antigen 5 (hyaluronidase) | ![]() |
1 | 1 | |||||||
MIRT582587 | Lrrtm2 | leucine rich repeat transmembrane neuronal 2 | ![]() |
1 | 1 | |||||||
MIRT582671 | Lin54 | lin-54 homolog (C. elegans) | ![]() |
1 | 1 | |||||||
MIRT582719 | Larp1 | La ribonucleoprotein domain family, member 1 | ![]() |
1 | 1 | |||||||
MIRT582727 | L3mbtl4 | l(3)mbt-like 4 (Drosophila) | ![]() |
1 | 2 | |||||||
MIRT582764 | Klf12 | Kruppel-like factor 12 | ![]() |
1 | 1 | |||||||
MIRT582858 | Ism1 | isthmin 1, angiogenesis inhibitor | ![]() |
1 | 1 | |||||||
MIRT582943 | Ikzf5 | IKAROS family zinc finger 5 | ![]() |
1 | 1 | |||||||
MIRT582999 | Id2 | inhibitor of DNA binding 2 | ![]() |
1 | 1 | |||||||
MIRT583061 | Hoxa11 | homeobox A11 | ![]() |
1 | 1 | |||||||
MIRT583100 | Hiat1 | major facilitator superfamily domain containing 14A | ![]() |
1 | 1 | |||||||
MIRT583108 | Hexim1 | hexamethylene bis-acetamide inducible 1 | ![]() |
1 | 1 | |||||||
MIRT583136 | Has2 | hyaluronan synthase 2 | ![]() |
1 | 1 | |||||||
MIRT583187 | Grhl3 | grainyhead-like 3 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT583231 | Gpc6 | glypican 6 | ![]() |
1 | 1 | |||||||
MIRT583391 | Fzd5 | frizzled class receptor 5 | ![]() |
1 | 1 | |||||||
MIRT583411 | Fzd1 | frizzled class receptor 1 | ![]() |
1 | 1 | |||||||
MIRT583425 | Fsd1l | fibronectin type III and SPRY domain containing 1-like | ![]() |
1 | 1 | |||||||
MIRT583527 | Fgf16 | fibroblast growth factor 16 | ![]() |
1 | 1 | |||||||
MIRT583544 | Fbxl20 | F-box and leucine-rich repeat protein 20 | ![]() |
1 | 1 | |||||||
MIRT583611 | Fam46a | family with sequence similarity 46, member A | ![]() |
1 | 1 | |||||||
MIRT583738 | Erc1 | ELKS/RAB6-interacting/CAST family member 1 | ![]() |
1 | 3 | |||||||
MIRT583770 | Ep300 | E1A binding protein p300 | ![]() |
1 | 1 | |||||||
MIRT583797 | Elavl4 | ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) | ![]() |
1 | 1 | |||||||
MIRT583817 | Eif2s1 | eukaryotic translation initiation factor 2, subunit 1 alpha | ![]() |
1 | 1 | |||||||
MIRT583953 | Dlx3 | distal-less homeobox 3 | ![]() |
1 | 1 | |||||||
MIRT584138 | Crebzf | CREB/ATF bZIP transcription factor | ![]() |
1 | 1 | |||||||
MIRT584210 | Cops7b | COP9 signalosome subunit 7B | ![]() |
1 | 1 | |||||||
MIRT584435 | Ccdc90b | coiled-coil domain containing 90B | ![]() |
1 | 1 | |||||||
MIRT584453 | Cbx3 | chromobox 3 | ![]() |
1 | 1 | |||||||
MIRT584467 | Casc4 | cancer susceptibility candidate 4 | ![]() |
1 | 1 | |||||||
MIRT584506 | Calm1 | calmodulin 1 | ![]() |
1 | 1 | |||||||
MIRT584735 | Atp2b2 | ATPase, Ca++ transporting, plasma membrane 2 | ![]() |
1 | 1 | |||||||
MIRT584809 | Arl15 | ADP-ribosylation factor-like 15 | ![]() |
1 | 1 | |||||||
MIRT584849 | Arhgap11a | Rho GTPase activating protein 11A | ![]() |
1 | 1 | |||||||
MIRT584997 | Ndnf | neuron-derived neurotrophic factor | ![]() |
1 | 1 | |||||||
MIRT585041 | Lrrc71 | leucine rich repeat containing 71 | ![]() |
1 | 1 | |||||||
MIRT585730 | Synpr | synaptoporin | ![]() |
1 | 1 | |||||||
MIRT585764 | Sri | sorcin | ![]() |
1 | 1 | |||||||
MIRT586097 | Reep5 | receptor accessory protein 5 | ![]() |
1 | 1 | |||||||
MIRT586120 | Rccd1 | RCC1 domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT587442 | Dimt1 | DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) | ![]() |
1 | 1 | |||||||
MIRT587533 | Cxxc5 | CXXC finger 5 | ![]() |
1 | 1 | |||||||
MIRT588362 | Zfp518b | zinc finger protein 518B | ![]() |
1 | 1 | |||||||
MIRT588472 | Wwtr1 | WW domain containing transcription regulator 1 | ![]() |
1 | 1 | |||||||
MIRT588619 | Trak2 | trafficking protein, kinesin binding 2 | ![]() |
1 | 1 | |||||||
MIRT588696 | Tet2 | tet methylcytosine dioxygenase 2 | ![]() |
1 | 1 | |||||||
MIRT588844 | Sort1 | sortilin 1 | ![]() |
1 | 1 | |||||||
MIRT588974 | Runx1t1 | runt-related transcription factor 1; translocated to, 1 (cyclin D-related) | ![]() |
1 | 1 | |||||||
MIRT589264 | Plau | plasminogen activator, urokinase | ![]() |
1 | 1 | |||||||
MIRT589381 | Ntrk3 | neurotrophic tyrosine kinase, receptor, type 3 | ![]() |
1 | 1 | |||||||
MIRT589449 | Nck2 | non-catalytic region of tyrosine kinase adaptor protein 2 | ![]() |
1 | 1 | |||||||
MIRT589536 | Mllt3 | myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3 | ![]() |
1 | 1 | |||||||
MIRT590500 | Cacnb2 | calcium channel, voltage-dependent, beta 2 subunit | ![]() |
1 | 1 | |||||||
MIRT590676 | Anln | anillin, actin binding protein | ![]() |
1 | 3 | |||||||
MIRT590761 | Acbd5 | acyl-Coenzyme A binding domain containing 5 | ![]() |
1 | 1 | |||||||
MIRT590795 | 4921524J17Rik | RIKEN cDNA 4921524J17 gene | ![]() |
1 | 1 | |||||||
MIRT593050 | Nf2 | neurofibromin 2 | ![]() |
1 | 1 | |||||||
MIRT594246 | Sox11 | SRY (sex determining region Y)-box 11 | ![]() |
1 | 1 | |||||||
MIRT594396 | Ints6 | integrator complex subunit 6 | ![]() |
1 | 1 | |||||||
MIRT594712 | Zwint | ZW10 interactor | ![]() |
1 | 1 | |||||||
MIRT594774 | Tex12 | testis expressed gene 12 | ![]() |
1 | 1 | |||||||
MIRT594790 | Slitrk2 | SLIT and NTRK-like family, member 2 | ![]() |
1 | 1 | |||||||
MIRT595122 | Mex3b | mex3 RNA binding family member B | ![]() |
1 | 1 | |||||||
MIRT595538 | Etv3 | ets variant 3 | ![]() |
1 | 1 | |||||||
MIRT595682 | Rnf6 | ring finger protein (C3H2C3 type) 6 | ![]() |
1 | 1 | |||||||
MIRT595833 | Tmem56 | transmembrane protein 56 | ![]() |
1 | 1 | |||||||
MIRT595896 | Cd69 | CD69 antigen | ![]() |
1 | 1 | |||||||
MIRT595962 | Znrf1 | zinc and ring finger 1 | ![]() |
1 | 1 | |||||||
MIRT595979 | Ocrl | OCRL, inositol polyphosphate-5-phosphatase | ![]() |
1 | 1 | |||||||
MIRT596009 | Ceacam1 | carcinoembryonic antigen-related cell adhesion molecule 1 | ![]() |
1 | 1 | |||||||
MIRT596190 | Lrig2 | leucine-rich repeats and immunoglobulin-like domains 2 | ![]() |
1 | 1 | |||||||
MIRT603671 | Olr1 | oxidized low density lipoprotein (lectin-like) receptor 1 | ![]() |
1 | 1 | |||||||
MIRT735076 | Hmgb1 | high mobility group box 1 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT755744 | Nos2 | nitric oxide synthase 2, inducible | 1 | 1 | ||||||||
MIRT755745 | Slc7a1 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 | 1 | 1 |