pre-miRNA Information
pre-miRNA mmu-mir-410   
Genomic Coordinates chr12: 109743715 - 109743795
Synonyms Mirn410, mmu-mir-410, Mir410
Description Mus musculus miR-410 stem-loop
Comment Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-410-3p
Sequence 50| AAUAUAACACAGAUGGCCUGU |70
Evidence Experimental
Experiments Northern
Putative Targets

Gene Information
Gene Symbol Nos2   
Synonyms MAC-NOS, NOS-II, Nos-2, Nos2a, i-NOS, iNOS
Description nitric oxide synthase 2, inducible
Transcript NM_010927   
Expression
Putative miRNA Targets on Nos2
3'UTR of Nos2
(miRNA target sites are highlighted)
>Nos2|NM_010927|3'UTR
   1 CAGCCCAGAGTTCCAGCTTCTGGCACTGAGTAAAGATAATGGTGAGGGGCTTGGGGAGACAGCGAAATGCAATCCCCCCC
  81 AAGCCCCTCATGTCATTCCCCCCTCCTCCACCCTACCAAGTAGTATTGTACTATTGTGGACTACTAAATCTCTCTCCTCT
 161 CCTCCCTCCCCTCTCTCCCTTTCCTCCCTTCTTCTCCACTCCCCAGCTCCCTCCTTCTCCTTCTCCTCCTTTGCCTCTCA
 241 CTCTTCCTTGGAGCTGAGAGCAGAGAAAAACTCAACCTCCTGACTGAAGCACTTTGGGTGACCACCAGGAGGCACCATGC
 321 CGCCGCTCTAATACTTAGCTGCACTATGTACAGATATTTATACTTCATATTTAAGAAAACAGATACTTTTGTCTACTCCC
 401 AATGATGGCTTGGGCCTTTCCTGTATAATTCCTTGATGAAAAATATTTATATAAAATACATTTTATTTTAATCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ugUCCGGUAGACACAAUAUaa 5'
            :|||| |:  || ||||  
Target 5' ttGGGCCTTTCCTG-TATAat 3'
410 - 429 91.00 -8.05
2
miRNA  3' uguCCGGUAGACA---CAAUAUAa 5'
             |||  |  ||   | || || 
Target 5' tctGGCACTGAGTAAAGATA-ATg 3'
19 - 41 62.00 -5.20
3
miRNA  3' uguccgguagacacAAUAUaa 5'
                        ||: |  
Target 5' cctctcactcttccTTGGAgc 3'
234 - 254 52.00 -5.60
154 mmu-miR-410-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT411453 Timp3 tissue inhibitor of metalloproteinase 3 1 1
MIRT429039 Nfib nuclear factor I/B 1 1
MIRT577363 Zbed6 zinc finger, BED type containing 6 1 1
MIRT577415 Ugt2b35 UDP glucuronosyltransferase 2 family, polypeptide B35 1 1
MIRT577447 Ttc17 tetratricopeptide repeat domain 17 1 1
MIRT577509 Tmem100 transmembrane protein 100 1 1
MIRT577583 Tcf21 transcription factor 21 1 1
MIRT577727 Slc12a8 solute carrier family 12 (potassium/chloride transporters), member 8 1 1
MIRT577749 Shh sonic hedgehog 1 1
MIRT577866 Rassf5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT577939 Ppp6r1 protein phosphatase 6, regulatory subunit 1 1 1
MIRT577946 Pou4f2 POU domain, class 4, transcription factor 2 1 1
MIRT577955 Pm20d2 peptidase M20 domain containing 2 1 1
MIRT578018 Pfkl phosphofructokinase, liver, B-type 1 2
MIRT578052 Pcdhb17 protocadherin beta 17 1 1
MIRT578199 Nadsyn1 NAD synthetase 1 1 1
MIRT578517 Igfbp3 insulin-like growth factor binding protein 3 1 1
MIRT578557 Hopx HOP homeobox 1 1
MIRT578586 Hist1h1d histone cluster 1, H1d 1 1
MIRT578724 Gm8369 predicted gene 8369 1 1
MIRT578808 Folh1 folate hydrolase 1 1 1
MIRT578868 Fam151b family with sequence similarity 151, member B 1 1
MIRT579020 Ctxn3 cortexin 3 1 1
MIRT579049 Crp C-reactive protein, pentraxin-related 1 1
MIRT579405 Akna AT-hook transcription factor 1 1
MIRT579630 Mettl20 electron transfer flavoprotein beta subunit lysine methyltransferase 1 1
MIRT579670 1200011I18Rik GPALPP motifs containing 1 1 1
MIRT579703 Zmynd8 zinc finger, MYND-type containing 8 1 1
MIRT579745 Zfp644 zinc finger protein 644 1 1
MIRT579786 Zfp384 zinc finger protein 384 1 1
MIRT579807 Zfp148 zinc finger protein 148 1 1
MIRT579834 Zfand5 zinc finger, AN1-type domain 5 1 1
MIRT579839 Zer1 zyg-11 related, cell cycle regulator 1 1
MIRT579858 Zc3hav1l zinc finger CCCH-type, antiviral 1-like 1 1
MIRT579995 Wnt3 wingless-type MMTV integration site family, member 3 1 1
MIRT580002 Wnt11 wingless-type MMTV integration site family, member 11 1 1
MIRT580021 Whsc1l1 nuclear receptor binding SET domain protein 3 1 1
MIRT580090 Usp6nl USP6 N-terminal like 1 1
MIRT580211 Ttc39b tetratricopeptide repeat domain 39B 1 1
MIRT580239 Trps1 transcriptional repressor GATA binding 1 1 1
MIRT580243 Trpc7 transient receptor potential cation channel, subfamily C, member 7 1 1
MIRT580411 Tmem161b transmembrane protein 161B 1 1
MIRT580506 Tfam transcription factor A, mitochondrial 1 1
MIRT580533 Tead3 TEA domain family member 3 1 1
MIRT580554 Tcf7l2 transcription factor 7 like 2, T cell specific, HMG box 1 1
MIRT580568 Tbx4 T-box 4 1 1
MIRT580612 Syp synaptophysin 1 1
MIRT580665 Strbp spermatid perinuclear RNA binding protein 1 1
MIRT580793 Snx27 sorting nexin family member 27 1 1
MIRT580819 Smurf2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT580868 Slc8a1 solute carrier family 8 (sodium/calcium exchanger), member 1 1 1
MIRT580880 Slc7a11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 1 1
MIRT580920 Slc35a1 solute carrier family 35 (CMP-sialic acid transporter), member 1 1 1
MIRT581144 Senp3 SUMO/sentrin specific peptidase 3 1 1
MIRT581245 Rufy2 RUN and FYVE domain-containing 2 1 1
MIRT581261 Rragb Ras-related GTP binding B 1 1
MIRT581293 Rnf166 ring finger protein 166 1 1
MIRT581352 Ret ret proto-oncogene 1 1
MIRT581388 Rbms3 RNA binding motif, single stranded interacting protein 1 1
MIRT581422 Rasal2 RAS protein activator like 2 1 1
MIRT581453 Ranbp10 RAN binding protein 10 1 1
MIRT581541 Pten phosphatase and tensin homolog 1 1
MIRT581573 Prrx1 paired related homeobox 1 1 1
MIRT581589 Lzts3 leucine zipper, putative tumor suppressor family member 3 1 1
MIRT581665 Ppp4r2 protein phosphatase 4, regulatory subunit 2 1 1
MIRT581738 Plxnc1 plexin C1 1 1
MIRT581791 Plaur plasminogen activator, urokinase receptor 1 1
MIRT581820 Pkib protein kinase inhibitor beta, cAMP dependent, testis specific 1 1
MIRT581893 Phf17 jade family PHD finger 1 1 1
MIRT581982 Pcsk5 proprotein convertase subtilisin/kexin type 5 1 1
MIRT582003 Pcdh20 protocadherin 20 1 1
MIRT582052 Osbp oxysterol binding protein 1 1
MIRT582100 Nupl2 nucleoporin like 2 1 1
MIRT582149 Nol7 nucleolar protein 7 1 1
MIRT582156 Nln neurolysin (metallopeptidase M3 family) 1 1
MIRT582256 Nckap5l NCK-associated protein 5-like 1 1
MIRT582373 Map1a microtubule-associated protein 1 A 1 1
MIRT582410 Mpped2 metallophosphoesterase domain containing 2 1 1
MIRT582442 Mgea5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT582587 Lrrtm2 leucine rich repeat transmembrane neuronal 2 1 1
MIRT582671 Lin54 lin-54 homolog (C. elegans) 1 1
MIRT582719 Larp1 La ribonucleoprotein domain family, member 1 1 1
MIRT582727 L3mbtl4 l(3)mbt-like 4 (Drosophila) 1 2
MIRT582764 Klf12 Kruppel-like factor 12 1 1
MIRT582858 Ism1 isthmin 1, angiogenesis inhibitor 1 1
MIRT582943 Ikzf5 IKAROS family zinc finger 5 1 1
MIRT582999 Id2 inhibitor of DNA binding 2 1 1
MIRT583061 Hoxa11 homeobox A11 1 1
MIRT583100 Hiat1 major facilitator superfamily domain containing 14A 1 1
MIRT583108 Hexim1 hexamethylene bis-acetamide inducible 1 1 1
MIRT583136 Has2 hyaluronan synthase 2 1 1
MIRT583187 Grhl3 grainyhead-like 3 (Drosophila) 1 1
MIRT583231 Gpc6 glypican 6 1 1
MIRT583391 Fzd5 frizzled class receptor 5 1 1
MIRT583411 Fzd1 frizzled class receptor 1 1 1
MIRT583425 Fsd1l fibronectin type III and SPRY domain containing 1-like 1 1
MIRT583527 Fgf16 fibroblast growth factor 16 1 1
MIRT583544 Fbxl20 F-box and leucine-rich repeat protein 20 1 1
MIRT583611 Fam46a family with sequence similarity 46, member A 1 1
MIRT583738 Erc1 ELKS/RAB6-interacting/CAST family member 1 1 3
MIRT583770 Ep300 E1A binding protein p300 1 1
MIRT583797 Elavl4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) 1 1
MIRT583817 Eif2s1 eukaryotic translation initiation factor 2, subunit 1 alpha 1 1
MIRT583953 Dlx3 distal-less homeobox 3 1 1
MIRT584138 Crebzf CREB/ATF bZIP transcription factor 1 1
MIRT584210 Cops7b COP9 signalosome subunit 7B 1 1
MIRT584435 Ccdc90b coiled-coil domain containing 90B 1 1
MIRT584453 Cbx3 chromobox 3 1 1
MIRT584467 Casc4 cancer susceptibility candidate 4 1 1
MIRT584506 Calm1 calmodulin 1 1 1
MIRT584735 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1 1
MIRT584809 Arl15 ADP-ribosylation factor-like 15 1 1
MIRT584849 Arhgap11a Rho GTPase activating protein 11A 1 1
MIRT584997 Ndnf neuron-derived neurotrophic factor 1 1
MIRT585041 Lrrc71 leucine rich repeat containing 71 1 1
MIRT585730 Synpr synaptoporin 1 1
MIRT585764 Sri sorcin 1 1
MIRT586097 Reep5 receptor accessory protein 5 1 1
MIRT586120 Rccd1 RCC1 domain containing 1 1 1
MIRT587442 Dimt1 DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) 1 1
MIRT587533 Cxxc5 CXXC finger 5 1 1
MIRT588362 Zfp518b zinc finger protein 518B 1 1
MIRT588472 Wwtr1 WW domain containing transcription regulator 1 1 1
MIRT588619 Trak2 trafficking protein, kinesin binding 2 1 1
MIRT588696 Tet2 tet methylcytosine dioxygenase 2 1 1
MIRT588844 Sort1 sortilin 1 1 1
MIRT588974 Runx1t1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT589264 Plau plasminogen activator, urokinase 1 1
MIRT589381 Ntrk3 neurotrophic tyrosine kinase, receptor, type 3 1 1
MIRT589449 Nck2 non-catalytic region of tyrosine kinase adaptor protein 2 1 1
MIRT589536 Mllt3 myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3 1 1
MIRT590500 Cacnb2 calcium channel, voltage-dependent, beta 2 subunit 1 1
MIRT590676 Anln anillin, actin binding protein 1 3
MIRT590761 Acbd5 acyl-Coenzyme A binding domain containing 5 1 1
MIRT590795 4921524J17Rik RIKEN cDNA 4921524J17 gene 1 1
MIRT593050 Nf2 neurofibromin 2 1 1
MIRT594246 Sox11 SRY (sex determining region Y)-box 11 1 1
MIRT594396 Ints6 integrator complex subunit 6 1 1
MIRT594712 Zwint ZW10 interactor 1 1
MIRT594774 Tex12 testis expressed gene 12 1 1
MIRT594790 Slitrk2 SLIT and NTRK-like family, member 2 1 1
MIRT595122 Mex3b mex3 RNA binding family member B 1 1
MIRT595538 Etv3 ets variant 3 1 1
MIRT595682 Rnf6 ring finger protein (C3H2C3 type) 6 1 1
MIRT595833 Tmem56 transmembrane protein 56 1 1
MIRT595896 Cd69 CD69 antigen 1 1
MIRT595962 Znrf1 zinc and ring finger 1 1 1
MIRT595979 Ocrl OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT596009 Ceacam1 carcinoembryonic antigen-related cell adhesion molecule 1 1 1
MIRT596190 Lrig2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT603671 Olr1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT735076 Hmgb1 high mobility group box 1 3 0
MIRT755744 Nos2 nitric oxide synthase 2, inducible 1 1
MIRT755745 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-410 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-410 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated

Error report submission