miRTarBase - #MIRT755775


—
pre-miRNA Information
pre-miRNA hsa-mir-4796   
Genomic Coordinates chr3: 114743445 - 114743525
Description Homo sapiens miR-4796 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4796-5p
Sequence 9| UGUCUAUACUCUGUCACUUUAC |30
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1466952984 15 dbSNP
rs887451291 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PARP2   
Synonyms ADPRT2, ADPRTL2, ADPRTL3, ARTD2, PARP-2, pADPRT-2
Description poly(ADP-ribose) polymerase 2
Transcript NM_001042618   
Other Transcripts NM_005484   
Expression
Putative miRNA Targets on PARP2
3'UTR of PARP2
(miRNA target sites are highlighted)		 
>PARP2|NM_001042618|3'UTR
   1 ATGTTGATATTAAATAAACCAGAGATCTGATCTTCAAGCAAGAAAATAAGCAGTGTTGTACTTGTGAATTTTGTGATATT
  81 TTATGTAATAAAAACTGTACAGGTCTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN8864663 10 COSMIC
COSN30107003 21 COSMIC
COSN26268480 32 COSMIC
COSN31535414 57 COSMIC
COSN30514697 62 COSMIC
COSN30154340 67 COSMIC
COSN31500687 84 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs2700 10 dbSNP
rs3093941 11 dbSNP
rs775732993 19 dbSNP
rs1184060108 20 dbSNP
rs1332094044 22 dbSNP
rs189651625 25 dbSNP
rs1240634350 27 dbSNP
rs370399705 28 dbSNP
rs1351067570 29 dbSNP
rs1208228772 35 dbSNP
rs1234939092 50 dbSNP
rs1044154086 58 dbSNP
rs1279342596 61 dbSNP
rs772828098 63 dbSNP
rs1227940319 74 dbSNP
rs1213049251 76 dbSNP
rs1290806566 77 dbSNP
rs544492535 88 dbSNP
rs774039648 89 dbSNP
rs1301484297 93 dbSNP
rs956554758 94 dbSNP
rs1360541508 96 dbSNP
rs1336813658 98 dbSNP
rs935664880 101 dbSNP
rs1052798099 102 dbSNP
rs562971051 104 dbSNP
rs1483393072 106 dbSNP
rs1201342916 107 dbSNP
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
29 hsa-miR-4796-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT446014 VNN1 vanin 1 2 2
MIRT493828 FRS2 fibroblast growth factor receptor substrate 2 2 6
MIRT506324 ONECUT2 one cut homeobox 2 2 2
MIRT515488 PRKCD protein kinase C delta 2 4
MIRT515543 KRT222 keratin 222 2 4
MIRT518502 DEPTOR DEP domain containing MTOR interacting protein 2 6
MIRT519278 DDX55 DEAD-box helicase 55 2 2
MIRT528638 SENP6 SUMO1/sentrin specific peptidase 6 2 2
MIRT532130 NOL11 nucleolar protein 11 2 2
MIRT558240 EDA2R ectodysplasin A2 receptor 2 2
MIRT562293 GLO1 glyoxalase I 2 2
MIRT575346 Cacul1 CDK2 associated, cullin domain 1 2 2
MIRT610250 SLC35B4 solute carrier family 35 member B4 2 2
MIRT616752 SVOP SV2 related protein 2 2
MIRT627810 PTCHD1 patched domain containing 1 2 4
MIRT643062 CCDC149 coiled-coil domain containing 149 2 2
MIRT652031 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT658708 EMB embigin 2 2
MIRT687624 LRRC40 leucine rich repeat containing 40 2 2
MIRT692723 INPP5B inositol polyphosphate-5-phosphatase B 2 2
MIRT697508 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT702301 LAMP3 lysosomal associated membrane protein 3 2 2
MIRT718288 MINA ribosomal oxygenase 2 2 2
MIRT755767 BRCC3 BRCA1/BRCA2-containing complex subunit 3 5 1
MIRT755769 BARD1 BRCA1 associated RING domain 1 5 1
MIRT755770 ATM ATM serine/threonine kinase 5 1
MIRT755771 PARP14 poly(ADP-ribose) polymerase family member 14 5 1
MIRT755775 PARP2 poly(ADP-ribose) polymerase 2 5 1
MIRT755777 PARP11 poly(ADP-ribose) polymerase family member 11 5 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4796-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4796-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4796-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)

Error report submission