pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-134 |
Genomic Coordinates | chr14: 101054687 - 101054759 |
Description | Homo sapiens miR-134 stem-loop |
Comment | miR-134 was first identified by cloning studies in mouse . |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-134-3p | |||||||||||||||||||||||||||
Sequence | 46| CCUGUGGGCCACCUAGUCACCAA |68 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | GPR137 | ||||||||||||||||||||
Synonyms | C11orf4, GPR137A, TM7SF1L1 | ||||||||||||||||||||
Description | G protein-coupled receptor 137 | ||||||||||||||||||||
Transcript | NM_001177358 | ||||||||||||||||||||
Other Transcripts | NM_001170726 , NM_001170881 , NM_001170880 , NM_020155 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on GPR137 | |||||||||||||||||||||
3'UTR of GPR137 (miRNA target sites are highlighted) |
>GPR137|NM_001177358|3'UTR 1 GCCGGGCTGGTATGGGGGCAGCCAGACGAAGACCACTCCTCTGCTCTTCTCCCAGGTGCCAGGACCAGGCGGCCACCACC 81 ACAGTCTCTACTCCACCCCACAGACGTGATCCCCCTCCCTCCCCCACAGAATACCCAGGCCCCAGTCCCCCTCACCCTAG 161 GCCCCTGTGCCAAGTTTGTCTGCCGCTTCTTGCCCAGGATCCTGGGGGTCGTGGCTACCCCCTCCTCTGGCCGGCTCCTT 241 GCTGCTCCTGTCATAGTGAGCTTGTGCCGTCCCCCTAGGATGGGGGGCATGGCCCTGGCTGCCAGATGCCCACAGCACCC 321 TGGCATGACCTGCCACCTCTGCTTCCACACCGGAGCCAGCTACCTCTCCTGTGCCTGCCACTCAATAAACAGTGTCTGCG 401 CCCCACAGTTGTGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
64 hsa-miR-134-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT082376 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT091883 | ACVR2B | activin A receptor type 2B | ![]() |
![]() |
2 | 4 | ||||||
MIRT094089 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | ![]() |
![]() |
2 | 4 | ||||||
MIRT316375 | PPP1R14C | protein phosphatase 1 regulatory inhibitor subunit 14C | ![]() |
![]() |
2 | 2 | ||||||
MIRT368317 | E2F2 | E2F transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446160 | RPL12 | ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458223 | SHMT2 | serine hydroxymethyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483575 | SYT2 | synaptotagmin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486251 | FASTK | Fas activated serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT487556 | TM6SF2 | transmembrane 6 superfamily member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT488952 | CYP2W1 | cytochrome P450 family 2 subfamily W member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489232 | ASCL2 | achaete-scute family bHLH transcription factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT491923 | WNK2 | WNK lysine deficient protein kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504191 | FAM127B | retrotransposon Gag like 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT517340 | ZNF529 | zinc finger protein 529 | ![]() |
![]() |
2 | 4 | ||||||
MIRT528964 | FAM19A3 | family with sequence similarity 19 member A3, C-C motif chemokine like | ![]() |
![]() |
2 | 2 | ||||||
MIRT530497 | FADS6 | fatty acid desaturase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539575 | UPP2 | uridine phosphorylase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549348 | ARC | activity regulated cytoskeleton associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT554316 | SHMT1 | serine hydroxymethyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555311 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT558029 | EXT1 | exostosin glycosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564075 | KIAA1191 | KIAA1191 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569986 | TMEM184A | transmembrane protein 184A | ![]() |
![]() |
2 | 2 | ||||||
MIRT570669 | INSIG1 | insulin induced gene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571911 | LSM14A | LSM14A, mRNA processing body assembly factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT574042 | PEX26 | peroxisomal biogenesis factor 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574076 | RNF152 | ring finger protein 152 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575774 | Tnfrsf10b | tumor necrosis factor receptor superfamily, member 10b | ![]() |
![]() |
2 | 2 | ||||||
MIRT576510 | Slc35e2 | solute carrier family 35, member E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609004 | PYGO1 | pygopus family PHD finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619992 | NPAP1 | nuclear pore associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630308 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636261 | RRAGC | Ras related GTP binding C | ![]() |
![]() |
2 | 2 | ||||||
MIRT638834 | CRTAP | cartilage associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT639813 | TMED8 | transmembrane p24 trafficking protein family member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641938 | SCOC | short coiled-coil protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT644770 | TXNRD3NB | thioredoxin reductase 3 neighbor | ![]() |
![]() |
2 | 2 | ||||||
MIRT650082 | MTL5 | testis expressed metallothionein like protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT651539 | WNK1 | WNK lysine deficient protein kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653695 | SLC25A33 | solute carrier family 25 member 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654579 | PXMP4 | peroxisomal membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655804 | NOVA2 | NOVA alternative splicing regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662741 | LRRC3C | leucine rich repeat containing 3C | ![]() |
![]() |
2 | 2 | ||||||
MIRT667588 | LONRF2 | LON peptidase N-terminal domain and ring finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667730 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667909 | ING1 | inhibitor of growth family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675875 | ATP1B4 | ATPase Na+/K+ transporting family member beta 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684043 | FOLR1 | folate receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686239 | ZMIZ1 | zinc finger MIZ-type containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710043 | POLL | DNA polymerase lambda | ![]() |
![]() |
2 | 2 | ||||||
MIRT711988 | EXTL3 | exostosin like glycosyltransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714061 | VHLL | VHL like | ![]() |
![]() |
2 | 2 | ||||||
MIRT715879 | ACIN1 | apoptotic chromatin condensation inducer 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716779 | C1orf229 | chromosome 1 open reading frame 229 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717104 | PXDC1 | PX domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723567 | ZBTB34 | zinc finger and BTB domain containing 34 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725668 | ABI2 | abl interactor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT735690 | SYT11 | synaptotagmin 11 | ![]() |
1 | 0 | |||||||
MIRT736843 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 0 | ||||||
MIRT736981 | MLH1 | mutL homolog 1 | ![]() |
1 | 0 | |||||||
MIRT737413 | FOXM1 | forkhead box M1 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT756143 | GPR137 | G protein-coupled receptor 137 | 3 | 1 | ||||||||
MIRT756411 | SOX9 | SRY-box 9 | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|