CircRNA Search

Keyword Field Query You can enter or select your queries into the database filters below and press the search button.

                 

  • Eg(circRNA)：chrX:84096194|84120027

  • Eg(miRNA)：hsa-miR-128-3p

  • Eg(gene)：A1BG

    • Input your interested sequence:

    Eg:

    >example_sequence
    ATATGGTGTTCTTATGTTTGAAATGCTTACTGGTACTCTGCCATTTCAAGGTAAAGACAGAAATGAGACCATGAAT

    Submit a fasta file:


    *Search will take about 10 seconds, please wait...

  • Eg：hsa_circ_0001955

  • Eg：hsa-GTPBP4_0005

  • Eg：ENSG00000000419

    • © 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab